mumuka
Established Member
- Reaction score
- 0
Establishment of type II 5a-reductase over-expressing cell line as an inhibitor screening model
Sunhyae Janga, Young Leea, Seong-Lok Hwangb, Min-Ho Leeb, Su Jin Parkb, In Ho Leeb, Sangjin Kangb, Seok-Seon Rohc, Young-Joon Seoa, Jang-Kyu Parka, Jeung-Hoon Leea and Chang Deok Kima, , aDepartment of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, Republic of Korea bLG Household and Health Care Research Park, Daejeon, Republic of Korea cOriental Medical College of Daejeon University, Daejeon, Republic of Korea Received 2 November 2006; accepted 14 March 2007. Available online 22 June 2007.
Abstract Dihydrotestosterone (DHT) is the most potent male hormone that causes androgenetic alopecia. The type II 5a-reductase is an enzyme that catalyzes the conversion of testosterone (T) to DHT, therefore it can be expected that specific inhibitors for type II 5a-reductase may improve the pathophysiologic status of androgenetic alopecia. In this study, we attempted to establish the reliable and convenient screening model for type II 5a-reductase inhibitors. After transfection of human cDNA for type II 5a-reductase into HEK293 cells, the type II 5a-reductase over-expressing stable cells were selected by G418 treatment. RT-PCR and Western blot analyses confirmed that type II 5a-reductase gene was expressed in the stable cells. In in vitro enzymatic assay, 10 µg of stable cell extract completely converted 1 µCi (0.015 nmol) of T into DHT. The type II 5a-reductase activity was inhibited by finasteride in a dose-dependent manner, confirming the reliability of screening system. In cell culture condition, 2 × 105 of stable cells completely converted all the input T (0.03 nmol) into DHT by 4 h incubation, demonstrating that the stable cell line can be used as a cell-based assay system. Using this system, we selected the extracts of Curcumae longae rhizoma and Mori ramulus as the potential inhibitors for type II 5a-reductase. These results demonstrate that the type II 5a-reductase over-expressing stable cell line is a convenient and reliable model for screening and evaluation of inhibitors.
Keywords: Type II 5a-reductase; Stable cell line; Screening model
Article Outline 1. Introduction 2. Materials and methods 2.1. Cloning of human type II 5a-reductase gene 2.2. Transient transfection 2.3. Establishment of stable cell line 2.4. Reverse transcription-polymerase chain reaction (RT-PCR) 2.5. Western blot analysis 2.6. 5a-Reductase assay 2.7. Natural extracts 2.8. MTT assay 3. Results 3.1. Establishment of type II 5a-reductase over-expressing cell line 3.2. Screening of type II 5a-reductase inhibitors 4. Discussion Acknowledgements Appendix A. Supplementary data References
1. Introduction Hair grows in a cyclical manner, characterized by a finite period of hair fiber production (anagen), a brief regression phase (catagen), and a resting period (telogen) [1], [2] and [3]. Although the precise mechanism underlying the hair growth regulation has not yet been fully understood, it is well known that androgens play fundamental roles in normal human hair growth [4] and [5]. After puberty, androgens stimulate the growth of beard, pubic and axillary hairs. In contrast, they can cause regression and balding on the scalp in genetically disposed individuals [4]. Androgens mediate their activities by binding to the human androgen receptor (AR), which belongs to the nuclear receptor superfamily and functions as a transcription factor. Upon binding ligand, AR undergoes a conformational change, translocates to the nucleus, and binds to the specific DNA sequence of target genes. These result in positive and/or negative regulation of gene expression [6]. Physiologically, two most important androgens are testosterone (T) and 5a-dihydrotestosterone (DHT). Although T and DHT can bind to the same AR, there is a clear difference between these two androgens, in terms of binding affinity potential. T has a two-fold lower binding affinity than DHT for the AR, and the dissociation rate of T from the receptor is five-fold faster than that of DHT [7]. For that reason, DHT is regarded as a stronger male hormone than T, and believed to be a major player in androgenetic alopecia [8].
Metabolically, DHT is made from T by the action of enzyme steroid 5a-reductase. This enzyme also catalyses the NADPH-dependent reduction of the ?4 double bond of several other steroid substrates [9] and [10]. So far, two distinct forms of 5a-reductase isoenzymes, called type I and type II, have been characterized, based on their different pH optima [11] and [12]. The structure of the type I and type II 5a-reductase genes is similar, however, the protein sequence homology is relatively low (about 47%) [13]. Type I 5a-reductase is predominantly expressed in the liver, adrenal gland, and non-genital skin [14], [15] and [16]. In the skin, the activity of type I 5a-reductase is concentrated in sebaceous gland, significantly higher in the face and scalp as compared with non-acne-prone areas [16], suggesting a regulatory role for sebum secretion. In contrast, type II 5a-reductase is expressed mainly in androgen-dependent tissues such as the prostate, epididymis, seminal vesicle, and hair follicle [12] and [13]. The concentration of DHT is higher in the balding scalp than in the non-balding scalp [17], and type II 5a-reductase is a predominant form in the dermal papilla (DP) cells [18] and [19], implicating the crucial role of type II 5a-reductase in initiating hair loss. This notion is further supported by a well-documented male pseudohermaphroditism where type II 5a-reductase is deficient and shows no androgenetic alopecia [20] and [21]. Therefore, many investigators have targeted this enzyme to develop the therapeutics for androgenetic alopecia. To screen the inhibitors for 5a-reductase, several experimental systems have been adopted. For instance, the in vitro enzymatic assay using the prostate tissues of human or experimental animals is preferentially used [22] and [23]. However, it is hard to obtain adequate amount of human specimens, not enabling the high-throughput screening for inhibitors. As for the rodent prostate as an enzyme source, there is about 60% homology between human and rodent type II 5a-reductase, making it difficult for direct extrapolation. To overcome these defects, in this study, we established human type II 5a-reductase over-expressing stable cell line, and tested the feasibility of a high-throughput screening model system.
2. Materials and methods 2.1. Cloning of human type II 5a-reductase gene Human cDNA for type II 5a-reductase was screened from human prostate cDNA library (Clontech, Mountain View, CA) by colony hybridization. The probe was made by polymerase chain reaction (PCR) using the primers 5'-ACGGTACTTCTGGGCCTCTT and 5'-ACAAGCCACCTTGTGGAATC (expected size 316 bp), which were designed against the sequence provided by GenBank (NM_000348). The full coding fragment for human type II 5a-reductase was amplified using the primers 5'-GCATGGATCCATGCAGGTTCAGTGCCAGCA and GCATGGATCCTTAAAAGATGAATGGAATAA, subcloned into eukaryotic expression vector pcDNA3.1(+) (Invitrogen, Carlsbad, CA), then sequence-verified. For making random mutants, PCR was performed with the wild type 5a-reductase cDNA as a template in a non-stringent condition (50 mM Tris–HCl, pH 9.0, 50 mM NaCl, 200 µM dNTPs, and 4 mM MgCl2) as follows: 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 2 min. PCR products were subcloned and sequence-verified.
2.2. Transient transfection Human embryonic kidney cells (HEK293) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco BRL, Rockville, MD). For transient transfection, 5 × 105 cells were plated in 100 mm culture dish and incubated overnight. Next day, 20 µg of plasmid DNA was combined with 62.5 mM CaCl2, 25 mM HEPES, pH 7.05, 70 mM NaCl, and 0.75 mM Na2HPO4, then transferred into the cell culture. After incubation for 12–16 h, DNA precipitate was removed and cells were further grown in fresh medium for 2 days.
2.3. Establishment of stable cell line HEK 293 cells (5 × 104) were plated in 35-mm culture dish, incubated overnight, and then transfected with 2 µg of plasmid DNA using Lipofectamine 2000 (Invitrogen), according to the manufacturer's protocol. After incubation with the growth medium for 2 days, cells were fed with DMEM/10% FBS containing G418 (1 mg/ml). The antibiotic-resistant cells were selected and expanded as the type II 5a-reductase over-expressing cell line.
2.4. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNAs were prepared using an Easy blue RNA isolation kit (Intron, Daejeon, Korea) according to the manufacturer's protocol. Two micrograms of total RNAs were reverse transcribed with M-MLV reverse transcriptase (Promega, Madison, WI). Aliquots of RT mixture were subjected to PCR cycles with the primers for type II 5a-reductase as follows: 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min for 25 cycles. For internal control, ß-actin primers (5'-CATGCCATCCTGCGTCTGGACCT and 5'-CCGGACTCATCGTACTCCTGCTTG, expected size 581 bp) were used.
2.5. Western blot analysis Cells were lysed in RIPA buffer (150 mM NaCl, 50 mM Tris, pH 7.4, 1 mM EDTA, 0.1% NP-40, and 0.2 mM PMSF). After vigorous pipetting, extracts were centrifuged for 15 min at 13,000 rpm. Total protein was measured using a Bradford protein assay kit (Bio-Rad Laboratories, Hercules, CA). Samples were run on 15% SDS-polyacrylamide gels, transferred onto PVDF membranes and incubated with anti-type II 5a-reductase antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for overnight at 4 °C with gentle agitation. Blots were then incubated with peroxidase-conjugated secondary antibody and developed by enhanced chemiluminescence (Amersham, Buckinghamshire, UK).
2.6. 5a-Reductase assay Stable cells were suspended in 50 mM sodium phosphate buffer (pH 5.5), and lysed by sonication for 1 min. After centrifugation at 13,000 rpm for 15 min, supernatant was harvested and total protein was measured using a Bradford protein assay kit. The reaction mixture for type II 5a-reductase contained 10 µl (1–100 µg total protein) of cell extract, 65 µl of reaction buffer (60 mM sodium phosphate, pH 5.5, 50 mM KCl, 1 mM NADPH, and 1 µCi [1,2,6,7-3H]testosterone (65.0 Ci/mmol, Amersham)), and 5 µl of test material. The reaction mixtures were incubated at 37 °C for 1 h, followed by steroids extraction with 250 µl of stop solution (70% cyclohexane, 30% ethylacetate, 40 µg/ml T, and 40 µg/ml DHT). Solvent was dried and steroids were reconstituted with 20 µl of chloroform, spotted onto thin layer chromatography (TLC) plate (Merck, Darmstadt, Germany) and developed in 80% toluene, 20% acetone. TLC plate was then exposed to Hyperfilm 3H (Amersham) for 5 days.
For steroids detection in culture medium, stable cells were plated in 24-well culture dish at the indicated concentrations. After incubation for 24 h, cells were re-fed with 0.5 ml of DMEM/10% FBS containing 2 µCi [3H]testosterone. Cells were further incubated at the indicated time points, then culture medium was transferred into new tube. Steroids were extracted with 2 volume of stop solution, then visualized by autoradiography.
2.7. Natural extracts The natural extracts were purchased from the Plant Diversity Research Center (PDRC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, Korea. The dried medicinal plants were crushed and extracted with cold methanol for 1 week. The methanol-extracts were concentrated in a vacuum evaporator (Büchi Labortechnik AG, Flawil, Switzerland) and resulting residues were weighed and dissolved to 1% solution in 50% ethanol.
2.8. MTT assay To test the cytotoxicity of test materials, MTT assay was carried out. Briefly, stable cells (2 × 104) were seeded on 24-well culture plate and treated with test materials for 24 h. MTT solution (1 mg/ml) was then added to the cultures and incubated for a further 4 h. Medium was removed and the formazan crystal obtained was solubilized in 200 µl of DMSO. Optical density was determined at 540 nm using an ELISA reader.
3. Results 3.1. Establishment of type II 5a-reductase over-expressing cell line We obtained the cDNA for human type II 5a-reductase by colony hybridization. To comparatively validate the functionality of cloned gene, we made several random mutants by PCR. Among those, we selected two mutants for a further experiment. One contained the mutation L110P, which is located at the predicted transmembrane domain (http://www.ensembl.org/Homo_sapiens/pro ... 39;db=core). Another contained the mutation A218T, which is located at the putative NADPH-binding and transmembrane domain (Fig. 1a) [24]. In transient transfection assay, the wild type 5a-reductase gene showed enzymatic activity, while two mutated genes did not show 5a-reductase activity (Fig. 1b).
Display Full Size version of this image (31K)
Fig. 1. Transient transfection of type II 5a-reductase gene. (a) A schematic of the protein coding region is shown in the center with the indicated exon numbers. Mutations that were made by non-stringent PCR are indicated below the schematic. (b) After transient transfection with DNA constructs, the expression of type II 5a-reductase was determined by RT-PCR. For enzymatic assay, the indicated amount of cell extracts was incubated with 1 µCi [3H]testosterone for 1 h. Steroids were extracted and analyzed by thin layer chromatograph. T, testosterone; DHT, 5a-dihydrotestosterone; L110P, L110P mutated construct; A218T, A218T mutated construct; WT, wild type construct.
To establish the type II 5a-reductase over-expressing cell line, the wild type gene was stably introduced into HEK293 cells. After selection against G418 for 2 weeks, we were able to get a stable cell line. To determine the expression of type II 5a-reductase in this cell line, we performed RT-PCR and Western blot analyses. As expected, the expression was detected in both the transcriptional and translational levels (Fig. 2), indicating that the type II 5a-reductase over-expressing stable cell line was well-established.
Display Full Size version of this image (25K)
Fig. 2. Expression of type II 5a-reductase in the stable cells. After transfection of type II 5a-reductase gene into HEK293 cells, the stable cells were selected by G418 treatment. The expression of type II 5a-reductase was determined by (a) RT-PCR and (b) Western blot analysis. For Western blot analysis, 100 µg of cell extract was loaded and separated in SDS-PAGE. 293, non-transfected HEK293 cells; 293-5aRII, type II 5a-reductase over-expressing stable HEK293 cells.
To measure the activity of type II 5a-reductase, cell extract was prepared by sonication in acidic buffer. Since type II 5a-reductase enzyme is mainly found in microsomal fraction [9], we measured enzymatic activity in the supernatant and pellet after centrifugation. As shown in Fig. 3a, type II 5a-reductase enzyme activity was detected in both the supernatant and pellet layer of the stable cell extract. We then determined the concentration-dependency of enzymatic activity using the supernatant of cell extract. As shown in Fig. 3b, T was converted into DHT in a dose-dependent manner (10 µg of stable cell extract completely converted 1 µCi (0.015 nmol) of input T into DHT). To test the feasibility of the stable cell line as a screening model system, we determined the effect of finasteride, a well-known inhibitor for type II 5a-reductase. Finasteride inhibited type II 5a-reductase activity in a dose-dependent manner (Fig. 3c), strengthening the possibility that our stable cell line can be used for the screening of type II 5a-reductase inhibitors.
Display Full Size version of this image (40K)
Fig. 3. Enzymatic activity of type II 5a-reductase. (a) Cell extracts were prepared by sonication, then separated into soluble supernant (S) and insoluble pellet (P). Ten micrograms of each extract was incubated with 1 µCi [3H]testosterone for 1 h. T, testosterone; DHT, 5a-dihydrotestosterone; 293, non-transfected HEK293 cells; 293-5aRII, type II 5a-reductase over-expressing stable HEK293 cells. (b) The indicated amount of cell extracts was incubated with 1 µCi [3H]testosterone for 1 h. The result shows the concentration-dependency of enzymatic activity. (c) Ten micrograms of stable cell extracts was incubated with 1 µCi [3H]testosterone and finasteride at the indicated concentrations for 1 h. The result shows that finasteride inhibits type II 5a-reductase in a dose-dependent manner.
3.2. Screening of type II 5a-reductase inhibitors In an attempt to screen the inhibitors for type II 5a-reductase, we first determined the inhibitory effect of natural extracts on enzymatic activity using the stable cell extract (in vitro tube reaction). As shown in Fig. 4a, several natural extracts showed marked inhibitory potential on type II 5a-reductase activity. The results of primary screening were summarized in Supplementary Table 1. We then selected 10 putative candidates and evaluated their inhibitory potential in a dose-dependency basis. As a result, we selected the extracts of Curcumae longae rhizoma and Mori ramulus, as the potential inhibitors for type II 5a-reductase (Fig. 4b).
Display Full Size version of this image (64K)
Fig. 4. Representative data for primary screening of type II 5a-reductase inhibitors using natural extracts. (a) Ten micrograms of stable cell extracts was incubated with 1 µCi [3H]testosterone and test materials (at the dose of 0.005%) for 1 h. Several materials that show the inhibitory effect were boxed. The detailed list of natural products and primary results can be found in Supplementary Table 1. (b) Ten micrograms of stable cell extracts was incubated with test materials at the indicated concentrations for 1 h. The extracts of Curcumae longae rhizoma (#15) and Mori ramulus (#213) were selected as the potential inhibitors for type II 5a-reductase. T, testosterone; DHT, 5a-dihydrotestosterone.
Next, we wanted to know whether our stable cell line can be used as a cell-based assay system. To this end, stable cells were incubated with [3H]testosterone for the indicated time points, and the steroids in the culture medium were analyzed. As shown in Fig. 5a, T was converted into DHT in cell number- and incubation time-dependent manners. In our condition, 2 × 105 of stable cells completely converted all the input T (0.03 nmol) into DHT by 4 h incubation. Using this cell-based assay method, we tested the inhibitory effect of several natural extracts that were selected from the primary in vitro screening. All natural extracts did not show cytotoxic effect at the indicated concentrations, determined by MTT assay (data not shown). Consistent with, the extract of C. longae rhizome showed the strongest inhibitory potential on type II 5a-reductase activity (Fig. 5b). However, its potential was at least 50 times lower than finasteride in weight-volume percentage.
Display Full Size version of this image (58K)
Fig. 5. Enzymatic activity of type II 5a-reductase in culture system. (a) The stable cells were plated in 24-well culture dish at the indicated concentrations and incubated with 2 µCi [3H]testosterone for the indicated time points. The result shows that T was converted into DHT in cell number- and incubation time-dependent manners. (b) The stable cells (2 × 105) were incubated with selected natural extracts for 4 h, then T to DHT conversion was determined. The extracts of Curcumae longae rhizoma (#15) and Mori ramulus (#213) were selected as the potential inhibitors for type II 5a-reductase. As a positive control, finasteride was incubated at the indicated concentrations. T, testosterone; DHT, 5a-dihydrotestosterone.
4. Discussion In this study, we established the type II 5a-reductase over-expressing cell line and tested the feasibility of a high-throughput screening model system. The enzymatic activity was detected in the in vitro tube reaction as well as the cell-based assay method, indicating that our stable cell line can be a good model for screening of type II 5a-reductase inhibitors.
Type II 5a-reductase is encoded by the SRD5A2 gene (NM_000348) located in chromosome 2p23, which is composed of five exons and four connected introns [24]. This enzyme has the membrane-bound characteristic, making it difficult to purify and structure-characterize. However, mutational studies indicate that type II 5a-reductase has the bipartite substrate binding pocket and carboxy-terminal cofactor binding site [25]. Additionally, computer-based structure prediction reveals six transmembrane helices (see above-mentioned website). In this study, we obtained two mutants, L110P and A218T, of human type II 5a-reductase gene and validated their enzymatic activity by transient transfection. As expected, L110P mutant construct failed to show type II 5a-reductase activity. As L110P mutation is located at third predicted transmembrane helix, our data potentiate the notion that membrane-bound characteristic of type II 5a-reductase is essential for its proper functionality. It has been previously suggested that NADPH-binding may stabilize the enzyme within the cell and variations in the intracellular levels of cofactor could regulate turnover of type II 5a-reductase [24]. In our experiment, A218T mutation at putative NADPH binding-site clearly abolished type II 5a-reductase activity, additionally providing the evidence that cofactor binding is critical for enzymatic activity.
As a preliminary step towards the development of type II 5a-reductase inhibitors, we tested the inhibitory effect of natural extracts. The natural extracts are widely used in oriental medicine in various diseases, and getting more popular even in western world recently. Although it has not yet been incorporated into the mainstream of medical care because of limited scientific evidence and lack of mechanistic understanding, alternative medicine using the natural extracts is becoming an increasingly attractive approach. In this study, we selected the extracts of C. longae rhizoma and M. ramulus, as the potential inhibitors for type II 5a-reductase. The rhizome of turmeric, C. longae, is widely used as a yellow coloring agent and spice in many foods. It is also used as a traditional medicine for the treatment of hepatic disorders and rheumatism [26]. In addition, it has been described that turmeric has anti-microbial, anti-inflammatory and anti-tumor activities [27] and [28]. Turmeric contains a number of curcuminoids, monoterpenoids, and sesquiterpenoids. Among those, curcuminoids have been extensively studied and demonstrated to have various biological activities. For example, curcumin irreversibly modifies thioredoxin reductase 1 (TrxR1) by alkylation of Cys496 and Sec497 residues in the presence of NADPH [29]. It has also been reported that curcuminoids including curcumin, bis-demethoxycurcumin, and tetrahydrocurcumin have anti-oxidative activities [30]. Interestingly, the oxidation of NADPH, in which the direct transfer of protons from NADPH to T is occurred, has been suggested to be an important step in enzymatic reaction of 5a-reductase [31]. Based on these results, we speculate that the inhibitory effect of turmeric extract on type II 5a-reductase is due to its non-specific anti-oxidant potential rather than direct inhibition of type II 5a-reductase itself. However, there is also a possibility that other components in turmeric extract can competitively or non-competitively inhibit type II 5a-reductase. The finding of active component and its molecular action mechanism will be an interesting further study.
In summary, we established the type II 5a-reductase over-expressing cell line and believed that this cell line is a convenient and reliable model for screening and evaluation of inhibitors, contributing the development of novel drugs for androgenetic alopecia.
Acknowledgements
This study was supported by a grant of the Korea Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (01-PJ3-PG6-01GN12-0001), and a grant from LG Household & Health Care Ltd. Jang S was supported by Brain Korea 21 Research Fellowship from the Korea Ministry of Education and Human Resources.
unk:
This study sounds very good to me but i would love to hear other people opinions about this. Thanks.
PS : Does anyone know a good reason why we shouldnt use topical curcumin?(colour does not count for me)
Sunhyae Janga, Young Leea, Seong-Lok Hwangb, Min-Ho Leeb, Su Jin Parkb, In Ho Leeb, Sangjin Kangb, Seok-Seon Rohc, Young-Joon Seoa, Jang-Kyu Parka, Jeung-Hoon Leea and Chang Deok Kima, , aDepartment of Dermatology and Research Institute for Medical Sciences, School of Medicine, Chungnam National University, Daejeon, Republic of Korea bLG Household and Health Care Research Park, Daejeon, Republic of Korea cOriental Medical College of Daejeon University, Daejeon, Republic of Korea Received 2 November 2006; accepted 14 March 2007. Available online 22 June 2007.
Abstract Dihydrotestosterone (DHT) is the most potent male hormone that causes androgenetic alopecia. The type II 5a-reductase is an enzyme that catalyzes the conversion of testosterone (T) to DHT, therefore it can be expected that specific inhibitors for type II 5a-reductase may improve the pathophysiologic status of androgenetic alopecia. In this study, we attempted to establish the reliable and convenient screening model for type II 5a-reductase inhibitors. After transfection of human cDNA for type II 5a-reductase into HEK293 cells, the type II 5a-reductase over-expressing stable cells were selected by G418 treatment. RT-PCR and Western blot analyses confirmed that type II 5a-reductase gene was expressed in the stable cells. In in vitro enzymatic assay, 10 µg of stable cell extract completely converted 1 µCi (0.015 nmol) of T into DHT. The type II 5a-reductase activity was inhibited by finasteride in a dose-dependent manner, confirming the reliability of screening system. In cell culture condition, 2 × 105 of stable cells completely converted all the input T (0.03 nmol) into DHT by 4 h incubation, demonstrating that the stable cell line can be used as a cell-based assay system. Using this system, we selected the extracts of Curcumae longae rhizoma and Mori ramulus as the potential inhibitors for type II 5a-reductase. These results demonstrate that the type II 5a-reductase over-expressing stable cell line is a convenient and reliable model for screening and evaluation of inhibitors.
Keywords: Type II 5a-reductase; Stable cell line; Screening model
Article Outline 1. Introduction 2. Materials and methods 2.1. Cloning of human type II 5a-reductase gene 2.2. Transient transfection 2.3. Establishment of stable cell line 2.4. Reverse transcription-polymerase chain reaction (RT-PCR) 2.5. Western blot analysis 2.6. 5a-Reductase assay 2.7. Natural extracts 2.8. MTT assay 3. Results 3.1. Establishment of type II 5a-reductase over-expressing cell line 3.2. Screening of type II 5a-reductase inhibitors 4. Discussion Acknowledgements Appendix A. Supplementary data References
1. Introduction Hair grows in a cyclical manner, characterized by a finite period of hair fiber production (anagen), a brief regression phase (catagen), and a resting period (telogen) [1], [2] and [3]. Although the precise mechanism underlying the hair growth regulation has not yet been fully understood, it is well known that androgens play fundamental roles in normal human hair growth [4] and [5]. After puberty, androgens stimulate the growth of beard, pubic and axillary hairs. In contrast, they can cause regression and balding on the scalp in genetically disposed individuals [4]. Androgens mediate their activities by binding to the human androgen receptor (AR), which belongs to the nuclear receptor superfamily and functions as a transcription factor. Upon binding ligand, AR undergoes a conformational change, translocates to the nucleus, and binds to the specific DNA sequence of target genes. These result in positive and/or negative regulation of gene expression [6]. Physiologically, two most important androgens are testosterone (T) and 5a-dihydrotestosterone (DHT). Although T and DHT can bind to the same AR, there is a clear difference between these two androgens, in terms of binding affinity potential. T has a two-fold lower binding affinity than DHT for the AR, and the dissociation rate of T from the receptor is five-fold faster than that of DHT [7]. For that reason, DHT is regarded as a stronger male hormone than T, and believed to be a major player in androgenetic alopecia [8].
Metabolically, DHT is made from T by the action of enzyme steroid 5a-reductase. This enzyme also catalyses the NADPH-dependent reduction of the ?4 double bond of several other steroid substrates [9] and [10]. So far, two distinct forms of 5a-reductase isoenzymes, called type I and type II, have been characterized, based on their different pH optima [11] and [12]. The structure of the type I and type II 5a-reductase genes is similar, however, the protein sequence homology is relatively low (about 47%) [13]. Type I 5a-reductase is predominantly expressed in the liver, adrenal gland, and non-genital skin [14], [15] and [16]. In the skin, the activity of type I 5a-reductase is concentrated in sebaceous gland, significantly higher in the face and scalp as compared with non-acne-prone areas [16], suggesting a regulatory role for sebum secretion. In contrast, type II 5a-reductase is expressed mainly in androgen-dependent tissues such as the prostate, epididymis, seminal vesicle, and hair follicle [12] and [13]. The concentration of DHT is higher in the balding scalp than in the non-balding scalp [17], and type II 5a-reductase is a predominant form in the dermal papilla (DP) cells [18] and [19], implicating the crucial role of type II 5a-reductase in initiating hair loss. This notion is further supported by a well-documented male pseudohermaphroditism where type II 5a-reductase is deficient and shows no androgenetic alopecia [20] and [21]. Therefore, many investigators have targeted this enzyme to develop the therapeutics for androgenetic alopecia. To screen the inhibitors for 5a-reductase, several experimental systems have been adopted. For instance, the in vitro enzymatic assay using the prostate tissues of human or experimental animals is preferentially used [22] and [23]. However, it is hard to obtain adequate amount of human specimens, not enabling the high-throughput screening for inhibitors. As for the rodent prostate as an enzyme source, there is about 60% homology between human and rodent type II 5a-reductase, making it difficult for direct extrapolation. To overcome these defects, in this study, we established human type II 5a-reductase over-expressing stable cell line, and tested the feasibility of a high-throughput screening model system.
2. Materials and methods 2.1. Cloning of human type II 5a-reductase gene Human cDNA for type II 5a-reductase was screened from human prostate cDNA library (Clontech, Mountain View, CA) by colony hybridization. The probe was made by polymerase chain reaction (PCR) using the primers 5'-ACGGTACTTCTGGGCCTCTT and 5'-ACAAGCCACCTTGTGGAATC (expected size 316 bp), which were designed against the sequence provided by GenBank (NM_000348). The full coding fragment for human type II 5a-reductase was amplified using the primers 5'-GCATGGATCCATGCAGGTTCAGTGCCAGCA and GCATGGATCCTTAAAAGATGAATGGAATAA, subcloned into eukaryotic expression vector pcDNA3.1(+) (Invitrogen, Carlsbad, CA), then sequence-verified. For making random mutants, PCR was performed with the wild type 5a-reductase cDNA as a template in a non-stringent condition (50 mM Tris–HCl, pH 9.0, 50 mM NaCl, 200 µM dNTPs, and 4 mM MgCl2) as follows: 94 °C for 1 min, 50 °C for 1 min, and 72 °C for 2 min. PCR products were subcloned and sequence-verified.
2.2. Transient transfection Human embryonic kidney cells (HEK293) were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (Gibco BRL, Rockville, MD). For transient transfection, 5 × 105 cells were plated in 100 mm culture dish and incubated overnight. Next day, 20 µg of plasmid DNA was combined with 62.5 mM CaCl2, 25 mM HEPES, pH 7.05, 70 mM NaCl, and 0.75 mM Na2HPO4, then transferred into the cell culture. After incubation for 12–16 h, DNA precipitate was removed and cells were further grown in fresh medium for 2 days.
2.3. Establishment of stable cell line HEK 293 cells (5 × 104) were plated in 35-mm culture dish, incubated overnight, and then transfected with 2 µg of plasmid DNA using Lipofectamine 2000 (Invitrogen), according to the manufacturer's protocol. After incubation with the growth medium for 2 days, cells were fed with DMEM/10% FBS containing G418 (1 mg/ml). The antibiotic-resistant cells were selected and expanded as the type II 5a-reductase over-expressing cell line.
2.4. Reverse transcription-polymerase chain reaction (RT-PCR) Total RNAs were prepared using an Easy blue RNA isolation kit (Intron, Daejeon, Korea) according to the manufacturer's protocol. Two micrograms of total RNAs were reverse transcribed with M-MLV reverse transcriptase (Promega, Madison, WI). Aliquots of RT mixture were subjected to PCR cycles with the primers for type II 5a-reductase as follows: 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min for 25 cycles. For internal control, ß-actin primers (5'-CATGCCATCCTGCGTCTGGACCT and 5'-CCGGACTCATCGTACTCCTGCTTG, expected size 581 bp) were used.
2.5. Western blot analysis Cells were lysed in RIPA buffer (150 mM NaCl, 50 mM Tris, pH 7.4, 1 mM EDTA, 0.1% NP-40, and 0.2 mM PMSF). After vigorous pipetting, extracts were centrifuged for 15 min at 13,000 rpm. Total protein was measured using a Bradford protein assay kit (Bio-Rad Laboratories, Hercules, CA). Samples were run on 15% SDS-polyacrylamide gels, transferred onto PVDF membranes and incubated with anti-type II 5a-reductase antibody (Santa Cruz Biotechnology, Santa Cruz, CA) for overnight at 4 °C with gentle agitation. Blots were then incubated with peroxidase-conjugated secondary antibody and developed by enhanced chemiluminescence (Amersham, Buckinghamshire, UK).
2.6. 5a-Reductase assay Stable cells were suspended in 50 mM sodium phosphate buffer (pH 5.5), and lysed by sonication for 1 min. After centrifugation at 13,000 rpm for 15 min, supernatant was harvested and total protein was measured using a Bradford protein assay kit. The reaction mixture for type II 5a-reductase contained 10 µl (1–100 µg total protein) of cell extract, 65 µl of reaction buffer (60 mM sodium phosphate, pH 5.5, 50 mM KCl, 1 mM NADPH, and 1 µCi [1,2,6,7-3H]testosterone (65.0 Ci/mmol, Amersham)), and 5 µl of test material. The reaction mixtures were incubated at 37 °C for 1 h, followed by steroids extraction with 250 µl of stop solution (70% cyclohexane, 30% ethylacetate, 40 µg/ml T, and 40 µg/ml DHT). Solvent was dried and steroids were reconstituted with 20 µl of chloroform, spotted onto thin layer chromatography (TLC) plate (Merck, Darmstadt, Germany) and developed in 80% toluene, 20% acetone. TLC plate was then exposed to Hyperfilm 3H (Amersham) for 5 days.
For steroids detection in culture medium, stable cells were plated in 24-well culture dish at the indicated concentrations. After incubation for 24 h, cells were re-fed with 0.5 ml of DMEM/10% FBS containing 2 µCi [3H]testosterone. Cells were further incubated at the indicated time points, then culture medium was transferred into new tube. Steroids were extracted with 2 volume of stop solution, then visualized by autoradiography.
2.7. Natural extracts The natural extracts were purchased from the Plant Diversity Research Center (PDRC), Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, Korea. The dried medicinal plants were crushed and extracted with cold methanol for 1 week. The methanol-extracts were concentrated in a vacuum evaporator (Büchi Labortechnik AG, Flawil, Switzerland) and resulting residues were weighed and dissolved to 1% solution in 50% ethanol.
2.8. MTT assay To test the cytotoxicity of test materials, MTT assay was carried out. Briefly, stable cells (2 × 104) were seeded on 24-well culture plate and treated with test materials for 24 h. MTT solution (1 mg/ml) was then added to the cultures and incubated for a further 4 h. Medium was removed and the formazan crystal obtained was solubilized in 200 µl of DMSO. Optical density was determined at 540 nm using an ELISA reader.
3. Results 3.1. Establishment of type II 5a-reductase over-expressing cell line We obtained the cDNA for human type II 5a-reductase by colony hybridization. To comparatively validate the functionality of cloned gene, we made several random mutants by PCR. Among those, we selected two mutants for a further experiment. One contained the mutation L110P, which is located at the predicted transmembrane domain (http://www.ensembl.org/Homo_sapiens/pro ... 39;db=core). Another contained the mutation A218T, which is located at the putative NADPH-binding and transmembrane domain (Fig. 1a) [24]. In transient transfection assay, the wild type 5a-reductase gene showed enzymatic activity, while two mutated genes did not show 5a-reductase activity (Fig. 1b).
Display Full Size version of this image (31K)
Fig. 1. Transient transfection of type II 5a-reductase gene. (a) A schematic of the protein coding region is shown in the center with the indicated exon numbers. Mutations that were made by non-stringent PCR are indicated below the schematic. (b) After transient transfection with DNA constructs, the expression of type II 5a-reductase was determined by RT-PCR. For enzymatic assay, the indicated amount of cell extracts was incubated with 1 µCi [3H]testosterone for 1 h. Steroids were extracted and analyzed by thin layer chromatograph. T, testosterone; DHT, 5a-dihydrotestosterone; L110P, L110P mutated construct; A218T, A218T mutated construct; WT, wild type construct.
To establish the type II 5a-reductase over-expressing cell line, the wild type gene was stably introduced into HEK293 cells. After selection against G418 for 2 weeks, we were able to get a stable cell line. To determine the expression of type II 5a-reductase in this cell line, we performed RT-PCR and Western blot analyses. As expected, the expression was detected in both the transcriptional and translational levels (Fig. 2), indicating that the type II 5a-reductase over-expressing stable cell line was well-established.
Display Full Size version of this image (25K)
Fig. 2. Expression of type II 5a-reductase in the stable cells. After transfection of type II 5a-reductase gene into HEK293 cells, the stable cells were selected by G418 treatment. The expression of type II 5a-reductase was determined by (a) RT-PCR and (b) Western blot analysis. For Western blot analysis, 100 µg of cell extract was loaded and separated in SDS-PAGE. 293, non-transfected HEK293 cells; 293-5aRII, type II 5a-reductase over-expressing stable HEK293 cells.
To measure the activity of type II 5a-reductase, cell extract was prepared by sonication in acidic buffer. Since type II 5a-reductase enzyme is mainly found in microsomal fraction [9], we measured enzymatic activity in the supernatant and pellet after centrifugation. As shown in Fig. 3a, type II 5a-reductase enzyme activity was detected in both the supernatant and pellet layer of the stable cell extract. We then determined the concentration-dependency of enzymatic activity using the supernatant of cell extract. As shown in Fig. 3b, T was converted into DHT in a dose-dependent manner (10 µg of stable cell extract completely converted 1 µCi (0.015 nmol) of input T into DHT). To test the feasibility of the stable cell line as a screening model system, we determined the effect of finasteride, a well-known inhibitor for type II 5a-reductase. Finasteride inhibited type II 5a-reductase activity in a dose-dependent manner (Fig. 3c), strengthening the possibility that our stable cell line can be used for the screening of type II 5a-reductase inhibitors.
Display Full Size version of this image (40K)
Fig. 3. Enzymatic activity of type II 5a-reductase. (a) Cell extracts were prepared by sonication, then separated into soluble supernant (S) and insoluble pellet (P). Ten micrograms of each extract was incubated with 1 µCi [3H]testosterone for 1 h. T, testosterone; DHT, 5a-dihydrotestosterone; 293, non-transfected HEK293 cells; 293-5aRII, type II 5a-reductase over-expressing stable HEK293 cells. (b) The indicated amount of cell extracts was incubated with 1 µCi [3H]testosterone for 1 h. The result shows the concentration-dependency of enzymatic activity. (c) Ten micrograms of stable cell extracts was incubated with 1 µCi [3H]testosterone and finasteride at the indicated concentrations for 1 h. The result shows that finasteride inhibits type II 5a-reductase in a dose-dependent manner.
3.2. Screening of type II 5a-reductase inhibitors In an attempt to screen the inhibitors for type II 5a-reductase, we first determined the inhibitory effect of natural extracts on enzymatic activity using the stable cell extract (in vitro tube reaction). As shown in Fig. 4a, several natural extracts showed marked inhibitory potential on type II 5a-reductase activity. The results of primary screening were summarized in Supplementary Table 1. We then selected 10 putative candidates and evaluated their inhibitory potential in a dose-dependency basis. As a result, we selected the extracts of Curcumae longae rhizoma and Mori ramulus, as the potential inhibitors for type II 5a-reductase (Fig. 4b).
Display Full Size version of this image (64K)
Fig. 4. Representative data for primary screening of type II 5a-reductase inhibitors using natural extracts. (a) Ten micrograms of stable cell extracts was incubated with 1 µCi [3H]testosterone and test materials (at the dose of 0.005%) for 1 h. Several materials that show the inhibitory effect were boxed. The detailed list of natural products and primary results can be found in Supplementary Table 1. (b) Ten micrograms of stable cell extracts was incubated with test materials at the indicated concentrations for 1 h. The extracts of Curcumae longae rhizoma (#15) and Mori ramulus (#213) were selected as the potential inhibitors for type II 5a-reductase. T, testosterone; DHT, 5a-dihydrotestosterone.
Next, we wanted to know whether our stable cell line can be used as a cell-based assay system. To this end, stable cells were incubated with [3H]testosterone for the indicated time points, and the steroids in the culture medium were analyzed. As shown in Fig. 5a, T was converted into DHT in cell number- and incubation time-dependent manners. In our condition, 2 × 105 of stable cells completely converted all the input T (0.03 nmol) into DHT by 4 h incubation. Using this cell-based assay method, we tested the inhibitory effect of several natural extracts that were selected from the primary in vitro screening. All natural extracts did not show cytotoxic effect at the indicated concentrations, determined by MTT assay (data not shown). Consistent with, the extract of C. longae rhizome showed the strongest inhibitory potential on type II 5a-reductase activity (Fig. 5b). However, its potential was at least 50 times lower than finasteride in weight-volume percentage.
Display Full Size version of this image (58K)
Fig. 5. Enzymatic activity of type II 5a-reductase in culture system. (a) The stable cells were plated in 24-well culture dish at the indicated concentrations and incubated with 2 µCi [3H]testosterone for the indicated time points. The result shows that T was converted into DHT in cell number- and incubation time-dependent manners. (b) The stable cells (2 × 105) were incubated with selected natural extracts for 4 h, then T to DHT conversion was determined. The extracts of Curcumae longae rhizoma (#15) and Mori ramulus (#213) were selected as the potential inhibitors for type II 5a-reductase. As a positive control, finasteride was incubated at the indicated concentrations. T, testosterone; DHT, 5a-dihydrotestosterone.
4. Discussion In this study, we established the type II 5a-reductase over-expressing cell line and tested the feasibility of a high-throughput screening model system. The enzymatic activity was detected in the in vitro tube reaction as well as the cell-based assay method, indicating that our stable cell line can be a good model for screening of type II 5a-reductase inhibitors.
Type II 5a-reductase is encoded by the SRD5A2 gene (NM_000348) located in chromosome 2p23, which is composed of five exons and four connected introns [24]. This enzyme has the membrane-bound characteristic, making it difficult to purify and structure-characterize. However, mutational studies indicate that type II 5a-reductase has the bipartite substrate binding pocket and carboxy-terminal cofactor binding site [25]. Additionally, computer-based structure prediction reveals six transmembrane helices (see above-mentioned website). In this study, we obtained two mutants, L110P and A218T, of human type II 5a-reductase gene and validated their enzymatic activity by transient transfection. As expected, L110P mutant construct failed to show type II 5a-reductase activity. As L110P mutation is located at third predicted transmembrane helix, our data potentiate the notion that membrane-bound characteristic of type II 5a-reductase is essential for its proper functionality. It has been previously suggested that NADPH-binding may stabilize the enzyme within the cell and variations in the intracellular levels of cofactor could regulate turnover of type II 5a-reductase [24]. In our experiment, A218T mutation at putative NADPH binding-site clearly abolished type II 5a-reductase activity, additionally providing the evidence that cofactor binding is critical for enzymatic activity.
As a preliminary step towards the development of type II 5a-reductase inhibitors, we tested the inhibitory effect of natural extracts. The natural extracts are widely used in oriental medicine in various diseases, and getting more popular even in western world recently. Although it has not yet been incorporated into the mainstream of medical care because of limited scientific evidence and lack of mechanistic understanding, alternative medicine using the natural extracts is becoming an increasingly attractive approach. In this study, we selected the extracts of C. longae rhizoma and M. ramulus, as the potential inhibitors for type II 5a-reductase. The rhizome of turmeric, C. longae, is widely used as a yellow coloring agent and spice in many foods. It is also used as a traditional medicine for the treatment of hepatic disorders and rheumatism [26]. In addition, it has been described that turmeric has anti-microbial, anti-inflammatory and anti-tumor activities [27] and [28]. Turmeric contains a number of curcuminoids, monoterpenoids, and sesquiterpenoids. Among those, curcuminoids have been extensively studied and demonstrated to have various biological activities. For example, curcumin irreversibly modifies thioredoxin reductase 1 (TrxR1) by alkylation of Cys496 and Sec497 residues in the presence of NADPH [29]. It has also been reported that curcuminoids including curcumin, bis-demethoxycurcumin, and tetrahydrocurcumin have anti-oxidative activities [30]. Interestingly, the oxidation of NADPH, in which the direct transfer of protons from NADPH to T is occurred, has been suggested to be an important step in enzymatic reaction of 5a-reductase [31]. Based on these results, we speculate that the inhibitory effect of turmeric extract on type II 5a-reductase is due to its non-specific anti-oxidant potential rather than direct inhibition of type II 5a-reductase itself. However, there is also a possibility that other components in turmeric extract can competitively or non-competitively inhibit type II 5a-reductase. The finding of active component and its molecular action mechanism will be an interesting further study.
In summary, we established the type II 5a-reductase over-expressing cell line and believed that this cell line is a convenient and reliable model for screening and evaluation of inhibitors, contributing the development of novel drugs for androgenetic alopecia.
Acknowledgements
This study was supported by a grant of the Korea Health 21 R&D Project, Ministry of Health & Welfare, Republic of Korea (01-PJ3-PG6-01GN12-0001), and a grant from LG Household & Health Care Ltd. Jang S was supported by Brain Korea 21 Research Fellowship from the Korea Ministry of Education and Human Resources.
unk:This study sounds very good to me but i would love to hear other people opinions about this. Thanks.
PS : Does anyone know a good reason why we shouldnt use topical curcumin?(colour does not count for me)
